Detail information of JCDBG00008
JCDBG00008
- ID
- JCDBG00008
- Name
- trnS-GCU
- Type
- tRNA
- Scaffold
- NC_012224.1
- Start
- 7464
- End
- 7551
- Strand
- -
- Link
- Genbank id:7636415
- Molecular function
- Cellular component
- Biological process
- KEGG
- Source
- RefSeq
- TF
- Description
- Sequence
- GGGAGAGATGGCTGAGTGGACTAAAGCGTCGGATTGCTAATCCGTTGTACGAGTTATTCGTACCGAGGGTTCGAATCCCT CTCTTTCC
- Gene structure
-
JCDB Genes gff download
JCDBG00008 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighboursMouse click the small gray square will display sample information.
JCDBG00008's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   
Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;co-expression network
node1 node2 type scc JCDBG00008 JCDBG01399 co-exp 1 JCDBG00008 JCDBG15096 co-exp 0.710229 JCDBG00008 JCDBG00322 co-exp 0.697658 JCDBG01399 JCDBG15096 co-exp 0.710229 JCDBG01399 JCDBG00322 co-exp 0.697658 PPI network
node1 node2 type
JCDBR00008
- ID
- JCDBR00008
- Name
- JCDBR00008
- Type
- Scaffold
- NC_012224.1
- Start
- 7464
- End
- 7551
- Strand
- -
- Exon
- 7464-7551
- Sequence
- GGGAGAGATGGCTGAGTGGACTAAAGCGTCGGATTGCTAATCCGTTGTACGAGTTATTCGTACCGAGGGTTCGAATCCCT CTCTTTCC
- Product
- tRNA-Ser
- Source
- RefSeq
- Link: